geneticslessons

How does forensic identification work? Any type of organism can be identified by examination of DNA sequences unique to that species. Identifying individuals within a species is less precise at this time, although when DNA sequencing technologies progress farther, direct comparison of very large DNA segments, and possibly even whole genomes, will become feasible and practical and will allow precise individual identification. To identify individuals, forensic scientists scan 13 DNA regions, or loci, that vary from person to person and use the data to create a DNA profile of that individual (sometimes called a DNA fingerprint). There is an extremely small chance that another person has the same DNA profile for a particular set of 13 regions. Some Examples of DNA Uses for Forensic Identification Identify potential suspects whose DNA may match evidence left at crime scenes Exonerate persons wrongly accused of crimes Identify crime and catastrophe victims Establish paternity and other family relationships Identify endangered and protected species as an aid to wildlife officials (could be used for prosecuting poachers) Detect bacteria and other organisms that may pollute air, water, soil, and food Match organ donors with recipients in transplant programs Determine pedigree for seed or livestock breeds Authenticate consumables such as caviar and wine Is DNA effective in identifying persons? DNA identification can be quite effective if used intelligently. Portions of the DNA sequence that vary the most among humans must be used; also, portions must be large enough to overcome the fact that human mating is not absolutely random. Consider the scenario of a crime scene investigation . . . Assume that type O blood is found at the crime scene. Type O occurs in about 45% of Americans. If investigators type only for ABO, finding that the "suspect" in a crime is type O really doesn't reveal very much. If, in addition to being type O, the suspect is a blond, and blond hair is found at the crime scene, you now have two bits of evidence to suggest who really did it. However, there are a lot of Type O blonds out there. If you find that the crime scene has footprints from a pair of Nike Air Jordans (with a distinctive tread design) and the suspect, in addition to being type O and blond, is also wearing Air Jordans with the same tread design, you are much closer to linking the suspect with the crime scene. In this way, by accumulating bits of linking evidence in a chain, where each bit by itself isn't very strong but the set of all of them together is very strong, you can argue that your suspect really is the right person. With DNA, the same kind of thinking is used; you can look for matches (based on sequence or on numbers of small repeating units of DNA sequence) at many different locations on the person's genome; one or two (even three) aren't enough to be confident that the suspect is the right one, but thirteen sites are used. A match at all thirteen is rare enough that you (or a prosecutor or a jury) can be very confident ("beyond a reasonable doubt") that the right person is accused. See some recent articles about statistical analysis on this topic: How is DNA typing done? Only one-tenth of a single percent of DNA (about 3 million bases) differs from one person to the next. Scientists can use these variable regions to generate a DNA profile of an individual, using samples from blood, bone, hair, and other body tissues and products. In criminal cases, this generally involves obtaining samples from crime-scene evidence and a suspect, extracting the DNA, and analyzing it for the presence of a set of specific DNA regions (markers).

In molecular genetics, an open reading frame (ORF) is the part of a reading frame that contains no stop codons. The transcription termination pause site is located after the ORF, beyond the translation stop codon, because if transcription were to cease before the stop codon, an incomplete protein would be made during translation. Normally, inserts which interrupt the reading frame of a subsequent region after the start codon cause frameshift mutation of the sequence and dislocate the sequences for stop codons. One common use of open reading frames is as one piece of evidence to assist in gene prediction. Long ORFs are often used, along with other evidence, to initially identify candidate protein coding regions in a DNA sequence. The presence of an ORF does not necessarily mean that the region is ever translated. For example in a randomly generated DNA sequence with an equal percentage of each nucleotide, a stop-codon would be expected once every 21 codons. A simple gene prediction algorithm for prokaryotes might look for a start codon followed by an open reading frame that is long enough to encode a typical protein, where the codon usage of that region matches the frequency characteristic for the given organism's coding regions. By itself even a long open reading frame is not conclusive evidence for the presence of a gene.

A karyotype is the representation of the chromosomes of any type of cell. For humans, the information their chromosomes provide is crucial to learning about the genome and diagnosing genetic diseases. Newly married couples are encouraged to get karyotyped to see if their children may be at a higher risk of inheriting genetic diseases. The results of karyotypes are written in a special notation that, while it may look confusing at first, is actually easy to learn and understand. Instructions 1 Count the number of pairs of chromosomes in the karyotype, except the sex chromosomes, the last two in the set. Write this number. In a normal human, the number will be 46. 2 Determine the sex chromosomes, whether they are "XX" or "XY." If they are "XX," the subject is a female; "XY," the subject is a male. Write this combination next to the number after a comma. In a normal woman, this will look like this "46, XX." 3 Note any irregularities in the karyotype. If the karyotype has an extra 21st chromosome, write "47, XX, +21, Trisomy-21," indicating the subject is a woman with 47 chromosomes and the extra chromosome is in the 21st pair. Having three chromosomes in a pair is called "Trisomy." If there is an extra sex chromosome, write 47, then the sex chromosomes; for example, "47, XXX." Tips & Warnings Consult a doctor or diagnostic manual to learn the names of disorders caused by chromosome irregularities, and write the disorder's name in the notation to make it more complete. For example, because an extra 21st chromosome is the cause of Down's syndrome, write the notation of the karyotype as "47, XY, +21,Trisomy-21, Down's Syndrome."

An isochromosome is a chromosome that has lost one of its arms and replaced it with an exact copy of the other arm. This is sometimes seen in some females with Turner syndrome or in tumor cells. This may also cause an isochromosome to have two centromeres. The chromosome arm is already copied during S phase of the cell cycle. During mitosis (or meiosis I or II), the sister chromatid sets line up along the midline in metaphase. The affected chromosome simply lines up at a right angle to its normal position, and as anaphase begins, the centromere is divided in the opposite plane from all the other chromosomes. This leaves the two long arms together and the two short arms together. The two new mirror-image chromosomes are pulled into opposite daughter cells. This produces two cells, each lacking one arm (e.g. the short arm) and containing an extra arm (e.g. the long arm) of the affected chromatid (or vice versa). It can also be formed by exchange involving one arm of a chromosome and its homolog (or sister chromatid) at the proximal edge of the arm, adjacent to the centromere. If the chromosomal material contains imprinted genes, there will either be a deletion or duplication of the genetic material (genes on the arm lost are deleted, genes on the arm mirrored are duplicated).

There are many differences between prokaryotic and eukaryotic cells. Some of these differences are structural whereas others are procedural. Two of the processes that are substantially different between prokaryotes and eukaryotes are gene expression and the regulation of it. Both types of cells transcribe DNA into mRNA, which is then translated into polypeptides, but the specifics of these processes differ. Location Prokaryotes lack nuclei and other organelles, which are specialized, membrane-bound compartments, whereas eukaryotes do have them. In fact, the word "eukaryote" means "true nucleus." In eukaryotes the cell's genome is located in the nucleus. Transcription thus occurs in the nucleus, and the mRNA transcript is subsequently exported through nuclear pores (pores in the nuclear envelope) to the cytoplasm for translation. By contrast, prokaryotic transcription and translation are not spatially or temporally segregated. Initiation of Transcription Promoter elements are short sequences of DNA that bind to a cell's transcriptional initiation factors. Prokaryotes have three promoter elements: one that is upstream of the gene being transcribed, one that is 10 nucleotides downstream of it and one that is 35 nucleotides downstream. Eukaryotes have a much larger set of promoter elements, the primary one being the TATA box. Eukaryotic transcription initiation factors assemble an initiation complex, which dissociates at the end of initiation. Prokaryotic transcription initiation factors do not assemble an initiation complex. Ribosomes Ribosomes are translation sites composed of RNA and protein that bind to a cell's mRNA and tRNA. Prokaryotes have 70S ribosomes whereas eukaryotes have 80S ribosomes. The "S" refers to the sedimentation coefficient, a measure of a particle's size, mass and shape. An 80S ribosome is composed of a 40S subunit and a 60S subunit while a 70S ribosome consists of a 30S subunit and a 50S subunit. Polycistronic mRNA In addition to having different transcription and translation machinery, prokaryotes and eukaryotes differ in their gene regulation. Eukaryotic regulation is much more complex and often relies on various feedback mechanisms, developmental processes and environmental factors. By contrast, prokaryotes regulate entire metabolic pathways rather than regulating each enzyme separately. Bacterial enzymes for a given pathway are adjacent to each other on a cell's DNA and are transcribed into one mRNA. This mRNA is called polycistronic mRNA. When a cell needs more or less of a pathway's enzymes, it simply transcribes more or less of that pathway's mRNA.

Variable Number Tandem Repeat DNA A Tandem repeat is defined as the repeated end-to-end duplication of a core DNA sequence at a defined locus (Webster). Because of their variation between individuals, these DNA segments are useful for identifying individuals for such purposes as linking a suspect to a crime scene. These are the famed "DNA fingerprints". The term "tandem" is often used to describe systems in which two parts are linked together, such as "tandem bicycle" (a bicycle built for two), "tandem jump" (a parachute jump in which student and instructor are tied together in the same harness), "tandem carriage" (a carriage drawn by two horses harnessed together), etc. Hence, a "tandem repeat" is DNA consisting of short, repeated base pair sequences "harnessed" together. (example: gatagatagatagatagata is a tandem repeat consisting of five repeats of tandem "GA" and "TA") Tandem repeat DNA sequences are also called "satellite DNA." There are three main types: A satellite is a highly repetitive DNA sequence with each repeated sequence ranging from a thousand to several thousand base pairs. The entire satellite can be up to 100 million base pairs long, and tend to occur in regions of heterochromatin (tightly wound regions of DNA that are usually not very actively transcribed; found near centromeres and telomeres, among other places.) !). Satellites are abundant on the Y chromosome, which makes a handy tool for those studying paternal genetic transmission in mammals. A minisatellite is an array of tandem repeats, with each repeat ranging from nine to 100 base pairs (but most commonly around 15 base pairs). The entire array is usually 500 to 30,000 base pairs long. These are most commonly found in euchromatin regions of the chromosome. A microsatellite is an array of very short repeats (2-6 base pairs each), with the entire array ranging from 10,000 to 100,000 base pairs in length. They have so far been found in the euchromatin regtions of vertebrate, insect and plant chromosomes. The number of repeats varies among individuals in a population, making microsatellites particularly useful to the population geneticist. Microsatellites... have many loci each have a high rate of mutation (10-3 - 10-4 mutations/site/generation, as opposed to 10-8 - 10-9 mutations/site/generation as in single nucleotide polymorphisms (SNPs) found throughout the genome in introns exons regulatory regions nonfunctional DNA sequences more rarely, in coding sequences (in trinucleotide repeat form) Microsatellites are screened from a genetic library, and the data stored in a computer by a Bioinformatics specialist. They are then part of a database of readily accessible, species-specific microsatellites that can be used to sequence and compare across genomes or within a species.

Gene expression is the process by which information from a gene is used in the synthesis of a functional gene product. These products are often proteins, but in non-protein coding genes such as rRNA genes or tRNA genes, the product is a functional RNA. The process of gene expression is used by all known life - eukaryotes (including multicellular organisms), prokaryotes (bacteria and archaea) and viruses - to generate the macromolecular machinery for life. Gene structure and gene expression in higher organisms Several steps in the gene expression process may be modulated, including the transcription, RNA splicing, translation, and post-translational modification of a protein. Gene regulation gives the cell control over structure and function, and is the basis for cellular differentiation, morphogenesis and the versatility and adaptability of any organism. Gene regulation may also serve as a substrate for evolutionary change, since control of the timing, location, and amount of gene expression can have a profound effect on the functions (actions) of the gene in a cell or in a multicellular organism. In genetics gene expression is the most fundamental level at which genotype gives rise to the phenotype. The genetic code is "interpreted" by gene expression, and the properties of the expression products give rise to the organism's phenotype.